Detection of the CaMV-35S Promoter Sequence in Maize Pollen and Seed | Semantic Scholar
Addgene
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
Sequencing data for MON810 35S promoter to show LAMP primer positions.... | Download Scientific Diagram
8
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Optimised LAMP allows single copy detection of 35Sp and NOSt in transgenic maize using Bioluminescent Assay in Real Time (BART) | Scientific Reports
Solved Here the 203bp CaMV 35 S promoter sequence that you | Chegg.com
Frontiers | Cauliflower mosaic virus (CaMV) Biology, Management, and Relevance to GM Plant Detection for Sustainable Organic Agriculture
Addgene: pP35S (GB0030)
A) Transformation vector pMZ766E1-CAT. CaMV 35S, cauliflower mosaic... | Download Scientific Diagram
Analysis of reporter proteins GUS and DsRed driven under the control of CaMV35S promoter in syncytia induced by beet cyst nematode Heterodera schachtii in Arabidopsis roots » Advancements in Life Sciences
a) Modular organization of the cauliflower mosaic virus 35S (35S)... | Download Scientific Diagram
You're eating viral DNA? - Biology Fortified Inc.
Promoters
CaMV35S promoter – A plant biology and biotechnology workhorse in the era of synthetic biology - ScienceDirect
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods | Scientific Reports
Plants | Free Full-Text | Evaluation of Plant-Derived Promoters for Constitutive and Tissue-Specific Gene Expression in Potato
Addgene: pMpGWB106
Part:BBa K1825004 - parts.igem.org
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Plants | Free Full-Text | A Core35S Promoter of Cauliflower Mosaic Virus Drives More Efficient Replication of Turnip Crinkle Virus
The Cauliflower Mosaic Virus 35S Promoter Extends into the Transcribed Region | Journal of Virology
